Stem-loop sequence hsv1-mir-H16

Accession MI0013890
Description Herpes Simplex Virus 1 miR-H16 stem-loop
Stem-loop
   c    ag     uua  -   ca      u   ---a    ag  - ac 
gcg agag  ccucg   ag agc  ggaggc ggg    ucga  gc c  a
||| ||||  |||||   || |||  |||||| |||    ||||  || |   
cgc ucuc  ggggc   uc ucg  cuuccg ccc    agcu  cg g  u
   u    ag     -cg  g   ac      c   cgca    cg  c ca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H16

Accession MIMAT0014694
Sequence

23 - 

ccaggaggcugggaucgaaggc

 - 44

Get sequence
Evidence experimental; Solexa [20181707]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).