Stem-loop sequence hsv1-mir-H15

Accession MI0013889
Description Herpes Simplex Virus 1 miR-H15 stem-loop
Stem-loop
      -a     caugc     g  g      -     c  g          uug  u 
5' acc  cagcg     gccgg cc uugugg ggccc gg ccggggcccc   gg c
   |||  |||||     ||||| || |||||| ||||| || ||||||||||   ||  
3' ugg  guugc     cggcc gg ggcacc ccggg cc ggccccgggg   cc c
      cg     -----     -  g      g     -  g          ---  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H15

Accession MIMAT0014693
Sequence

62 - 

ggccccgggccgggccgccacg

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).