Stem-loop sequence hsv1-mir-H14

AccessionMI0013888
DescriptionHerpes Simplex Virus 1 miR-H14 stem-loop
Gene family MIPF0001214; mir-H2
Stem-loop
          -  a       u  u   u   u     - gcgaac 
gccgugugcc cc gucgcac cg ccc ggc caggc c      c
|||||||||| || ||||||| || ||| ||| ||||| |       
cggcgcgcgg gg cagcgug gc ggg ccg gucug g      a
          u  -       c  -   -   u     a acaaga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H14-5p

Accession MIMAT0014691
Sequence

13 - 

agucgcacucgucccuggcucagg

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hsv1-miR-H14-3p

Accession MIMAT0014692
Sequence

56 - 

ucugugccgggcgcgugcgac

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).