Stem-loop sequence hsv1-mir-H13

AccessionMI0013887
DescriptionHerpes Simplex Virus 1 miR-H13 stem-loop
Gene family MIPF0000833; mir-H11
Stem-loop
   -a  c               c    uau 
gcg  ag guucgcacuucgucc aaua   a
|||  || ||||||||||||||| ||||   u
cgc  uc cgagcgugaagcggg uuau   a
   gg  a               a    uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H13

Accession MIMAT0014690
Sequence

39 - 

uuagggcgaagugcgagcacugg

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).