Stem-loop sequence hsv1-mir-H12

Accession MI0013886
Description Herpes Simplex Virus 1 miR-H12 stem-loop
Gene family MIPF0000833; mir-H11
Stem-loop
        c   c   g  cc    c          c       aua 
5' ggagu ggg acg cg  agug ucgcacuucg ccuaaua   u
   ||||| ||| ||| ||  |||| |||||||||| |||||||   a
3' cuuca cuc ugc gc  ucgc agcgugaagc ggguuau   u
        -   u   -  -u    a          a       aua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H12

Accession MIMAT0014689
Sequence

53 - 

uugggacgaagugcgaacgcuu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).