Stem-loop sequence hsv1-mir-H11

AccessionMI0013885 (change log)
DescriptionHerpes Simplex Virus 1 miR-H11 stem-loop
Gene family MIPF0000833; mir-H11
5' gggcguggccgcuauuauaaaaaaagugagaacgcgaagcguucgcacuuuguccuaauaaua a
3' cccgcaccggcgauaauauuuuuuucacucuugcgcuucgcaagcgugaaacaggauuauuau u
Get sequence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv1-miR-H11

Accession MIMAT0014688

73 - 


 - 92

Get sequence
Evidence experimental; Illumina [1]


PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).