Stem-loop sequence hsv1-mir-H11

Accession MI0013885
Description Herpes Simplex Virus 1 miR-H11 stem-loop
Gene family MIPF0000833; mir-H11
Stem-loop
                                                               u 
gggcguggccgcuauuauaaaaaaagugagaacgcgaagcguucgcacuuuguccuaauaaua a
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  
cccgcaccggcgauaauauuuuuuucacucuugcgcuucgcaagcgugaaacaggauuauuau u
                                                               a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H11

Accession MIMAT0014688
Sequence

73 - 

uuaggacaaagugcgaacgc

 - 92

Get sequence
Evidence experimental; Solexa [20181707]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).