Stem-loop sequence bmo-mir-2733a-2

AccessionMI0013858 (change log)
DescriptionBombyx mori miR-2733a-2 stem-loop
Gene family MIPF0000766; mir-2733
Literature search

1 open access papers mention bmo-mir-2733a-2
(4 sentences)

Stem-loop
          -     u c            a        -------ucaccaca     c  cc 
5' uauauca cuggg g augaugauugug uagagaga               ucacg ug  a
   ||||||| ||||| | |||||||||||| ||||||||               ||||| ||   
3' guauagu gacuc c uacuacugacgu aucucucu               agugu ac  u
          u     u a            a        cuauaucuucucuac     -  au 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 346489-346605 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2733a-2
bmo-mir-9dNW_004581684.1: 354559-354643 [-]
bmo-mir-2733cNW_004581684.1: 353724-353805 [-]
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
bmo-mir-2733e-1NW_004581684.1: 342896-342993 [-]
bmo-mir-2733e-2NW_004581684.1: 342566-342664 [-]
Database links

Mature sequence bmo-miR-2733a-5p

Accession MIMAT0012611
Previous IDsbmo-miR-2733a
Sequence

5 - 

ucacugggugcaugaugauugu

 - 26

Get sequence
Deep sequencing43 reads, 2 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).