Stem-loop sequence bmo-mir-2733g

AccessionMI0013857 (change log)
DescriptionBombyx mori miR-2733g stem-loop
Gene family MIPF0000766; mir-2733
Literature search

1 open access papers mention bmo-mir-2733g
(4 sentences)

Stem-loop
        -  g  u c    a      gg  c     ucauc   -------------     c 
5' uauca cu gg g auga gauugu  ua agaga     aca             ucacg c
   ||||| || || | |||| ||||||  || |||||     |||             |||||  
3' auagu ga uc c uacu cugacg  au ucucu     ugu             agugc g
        u  g  u a    a      ua  c     cuuuc   cgaucuucucuac     c 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 347847-347958 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2733g
bmo-mir-9dNW_004581684.1: 354559-354643 [-]
bmo-mir-2733cNW_004581684.1: 353724-353805 [-]
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
bmo-mir-2733e-1NW_004581684.1: 342896-342993 [-]
bmo-mir-2733e-2NW_004581684.1: 342566-342664 [-]
Database links

Mature sequence bmo-miR-2733g

Accession MIMAT0014662
Sequence

3 - 

ucacugggugcaugaagauug

 - 23

Get sequence
Deep sequencing21 reads, 2 experiments
Evidence experimental; Illumina [1], SOLID [2]

References

1
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).