Stem-loop sequence bmo-mir-2999

AccessionMI0013855 (change log)
DescriptionBombyx mori miR-2999 stem-loop
Literature search

1 open access papers mention bmo-mir-2999
(1 sentences)

Stem-loop
    g      -  -----    c   --g        --------------     -uu   cu   g 
5' c cccgcg cg     gcug gac   gacuagac              gcgca   uuc  cgg c
   | |||||| ||     |||| |||   ||||||||              |||||   |||  |||  
3' g gggugu gc     ugau uug   uugauuug              cgcgu   aag  guc u
    g      u  auuau    u   uua        uuuauugacuuuga     ucc   uu   g 
Get sequence
Deep sequencing
385 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581688.1: 951610-951720 [+]
intergenic
Database links

Mature sequence bmo-miR-2999

Accession MIMAT0014660
Sequence

12 - 

cugcgacggacuagacgcgca

 - 32

Get sequence
Deep sequencing369 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).