Stem-loop sequence bmo-mir-2998

AccessionMI0013854 (change log)
DescriptionBombyx mori miR-2998 stem-loop
Literature search

1 open access papers mention bmo-mir-2998
(5 sentences)

Stem-loop
           ga  a   -  -   aa    uu    ag  g     --  a 
5' aagaacag  ug ggu ag aua  cagg  aagg  ug cugga  ac a
   ||||||||  || ||| || |||  ||||  ||||  || |||||  || g
3' uucuuguu  ac ccg uc uau  gucu  uuuc  au ggcuu  ug g
           -a  -   a  a   aa    --    ga  g     au  a 
Get sequence
Deep sequencing
837 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581712.1: 4762-4856 [+]
intergenic
NW_004582017.1: 3512109-3512203 [-]
intergenic
NW_004582020.1: 5921517-5921611 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2998
bmo-mir-3238NW_004581712.1: 3566-3680 [+]
bmo-mir-2998NW_004581712.1: 4762-4856 [+]
Database links

Mature sequence bmo-miR-2998

Accession MIMAT0014659
Sequence

1 - 

aagaacaggaugagguagauaaa

 - 23

Get sequence
Deep sequencing765 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).