Stem-loop sequence tgu-mir-15c

AccessionMI0013850 (change log)
DescriptionTaeniopygia guttata miR-15c stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
           a    ua     a  uc          gggac 
5' cuuugagg gaug  gcagc ca  augguuugua     a
   |||||||| ||||  ||||| ||  ||||||||||      
3' ggaacucc uuac  cgucg gu  uaccagacau     a
           a    uc     g  cu          agagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr4A: 7177772-7177853 [+]
intergenic
Clustered miRNAs
< 10kb from tgu-mir-15c
tgu-mir-15cchr4A: 7177772-7177853 [+]
tgu-mir-16cchr4A: 7178185-7178256 [+]
Database links

Mature sequence tgu-miR-15c-5p

Accession MIMAT0014619
Sequence

14 - 

uagcagcacaucaugguuugu

 - 34

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence tgu-miR-15c-3p

Accession MIMAT0027025
Sequence

50 - 

cagaccauucugggcugccuca

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).