Stem-loop sequence tgu-mir-489

AccessionMI0013849 (change log)
DescriptionTaeniopygia guttata miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
   u   --ac ug ug c    ug             c      ua     a 
5'  guc    g  g  g uugg  gucguauguauga gucauu  cuugg c
    |||    |  |  | ||||  ||||||||||||| ||||||  |||||  
3'  cag    c  c  c aauc  cggcauguauacu caguga  ggauu u
   a   ggua gu gu a    gu             a      --     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr2: 25436279-25436376 [-]
intergenic
Database links

Mature sequence tgu-miR-489-5p

Accession MIMAT0027024
Sequence

19 - 

uggucguauguaugacgucauu

 - 40

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-489-3p

Accession MIMAT0014618
Sequence

58 - 

gugacaucauauguacggcugc

 - 79

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).