Stem-loop sequence tgu-mir-205

AccessionMI0013846 (change log)
DescriptionTaeniopygia guttata miR-205 stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
        c    u cc       c   c        ---  ga 
5' gccuu cugg g  cuucauu cac ggaaucug   uc  u
   ||||| |||| |  ||||||| ||| ||||||||   ||   
3' cggaa gacu c  gaaguaa gug cuuuaggc   ag  g
        a    c cc       a   a        cca  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1A: 622279-622359 [-]
sense
ENSTGUT00000018655 ; tgu-mir-205-201; exon 1
Database links

Mature sequence tgu-miR-205

Accession MIMAT0014616
Sequence

13 - 

cccuucauuccaccggaaucug

 - 34

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).