Stem-loop sequence tgu-mir-146c

AccessionMI0013839 (change log)
DescriptionTaeniopygia guttata miR-146c stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   uucucagcuuu         a           guaau   auc 
5'            gagaacuga uuccauggguu     uga   u
              ||||||||| |||||||||||     |||    
3'            uucuugacu gggguacccag     acu   g
   -----------         c           -----   guc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr13: 11635088-11635159 [+]
sense
ENSTGUT00000018331 ; tgu-mir-146c-201; exon 1
Database links

Mature sequence tgu-miR-146c

Accession MIMAT0014609
Sequence

11 - 

ugagaacugaauuccauggguu

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).