Stem-loop sequence tgu-mir-146b

AccessionMI0013832 (change log)
DescriptionTaeniopygia guttata miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   ugcuuggcu   -          u       -    gaag 
5'          cug agaacugaau ccauagg cguu    c
            ||| |||||||||| ||||||| ||||    c
3'          gac ucuugacuua gguaucc guaa    u
   --------c   g          -       c    aacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr6: 22623576-22623647 [+]
sense
ENSTGUT00000018363 ; tgu-mir-146b-201; exon 1
Database links

Mature sequence tgu-miR-146b-5p

Accession MIMAT0014602
Previous IDstgu-miR-146b
Sequence

11 - 

ugagaacugaauuccauaggcg

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence tgu-miR-146b-3p

Accession MIMAT0014652
Previous IDstgu-miR-146b*
Sequence

48 - 

ugcccuauggauucaguucugc

 - 69

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).