Stem-loop sequence tgu-mir-15b

AccessionMI0013825 (change log)
DescriptionTaeniopygia guttata miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   cgaagug           c              g  cu 
5'        cuguagcagca aucaugguuugcau cu  g
          ||||||||||| |||||||||||||| ||   
3'        gaugucgucgu uaguacuaaacgug ga  c
   -------           u              g  cu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr9: 25555991-25556061 [-]
sense
ENSTGUT00000018722 ; tgu-mir-15b-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-15b
tgu-mir-15bchr9: 25555991-25556061 [-]
tgu-mir-16bchr9: 25555835-25555906 [-]
Database links

Mature sequence tgu-miR-15b-5p

Accession MIMAT0014597
Sequence

11 - 

uagcagcacaucaugguuugc

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-15b-3p

Accession MIMAT0027020
Sequence

49 - 

caaaucaugauuugcugcugu

 - 69

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).