Stem-loop sequence tgu-mir-20b

AccessionMI0013819 (change log)
DescriptionTaeniopygia guttata miR-20b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   cuagca    -ca           g     g   c  gg 
5'       guau   aagugcucaua ugcag uag uu  a
         ||||   ||||||||||| ||||| ||| ||  a
3'       caug   uucacgggugu auguc auc ag  a
   ------    aca           a     -   c  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr4A: 7274092-7274164 [+]
sense
ENSTGUT00000018772 ; tgu-mir-20b-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-20b
tgu-mir-106chr4A: 7273746-7273818 [+]
tgu-mir-18bchr4A: 7273805-7273936 [+]
tgu-mir-20bchr4A: 7274092-7274164 [+]
tgu-mir-19b-2chr4A: 7274224-7274296 [+]
tgu-mir-92-2chr4A: 7274404-7274495 [+]
tgu-mir-363chr4A: 7274550-7274638 [+]
Database links

Mature sequence tgu-miR-20b-5p

Accession MIMAT0014591
Sequence

11 - 

caaagugcucauagugcagguag

 - 33

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence tgu-miR-20b-3p

Accession MIMAT0027017
Sequence

49 - 

acuguaaugugggcacuuaca

 - 69

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).