Stem-loop sequence tgu-mir-16c

AccessionMI0013814 (change log)
DescriptionTaeniopygia guttata miR-16c stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   agcagugcucu       cgua          ---uu    a 
5'            agcagca    aauacuggag     uggg u
              |||||||    ||||||||||     ||||  
3'            ucgucgu    uuaugaccuc     gucc u
   -----------       uacg          ucguu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr4A: 7178185-7178256 [+]
sense
ENSTGUT00000018454 ; tgu-mir-16c-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-16c
tgu-mir-15cchr4A: 7177772-7177853 [+]
tgu-mir-16cchr4A: 7178185-7178256 [+]
Database links

Mature sequence tgu-miR-16c

Accession MIMAT0014586
Sequence

11 - 

uagcagcacguaaauacuggag

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).