Stem-loop sequence tgu-mir-16a

AccessionMI0013811 (change log)
DescriptionTaeniopygia guttata miR-16a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -----------u   a              -  a        u uuaagac 
5'             guc uacuuuagcagcac gu aauauugg g       u
               ||| |||||||||||||| || |||||||| |        
3'             cgg augaagucgucgug ca uuaugacc c       g
   gucuucaccgau   a              u  a        u uauaaau 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1: 55910032-55910123 [+]
sense
ENSTGUT00000018487 ; tgu-mir-16a-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-16a
tgu-mir-15achr1: 55909891-55909961 [+]
tgu-mir-16achr1: 55910032-55910123 [+]
Database links

Mature sequence tgu-miR-16a-5p

Accession MIMAT0014583
Previous IDstgu-miR-16a
Sequence

11 - 

uagcagcacguaaauauuggug

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-16a-3p

Accession MIMAT0014647
Previous IDstgu-miR-16a*
Sequence

51 - 

ccaguauuaacugugcugcuga

 - 72

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).