Stem-loop sequence tgu-mir-365-2

AccessionMI0013810 (change log)
DescriptionTaeniopygia guttata miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   ugcccuccuggggaccgacugagcggca       a        ac   c       -----    u   u 
5'                             gcaagaa aaugaggg  uuu aggggca     gcug guu u
                               ||||||| ||||||||  ||| |||||||     |||| ||| a
3'                             cguucuu uuauuccu  aaa uccccgu     ugac caa c
   ---------------------------a       g        aa   -       aauac    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr18: 11031436-11031547 [+]
sense
ENSTGUT00000018346 ; tgu-mir-365-2-201; exon 1
Database links

Mature sequence tgu-miR-365-2-5p

Accession MIMAT0031088
Sequence

40 - 

gagggacuuucaggggcagcugu

 - 62

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-365-3p

Accession MIMAT0014582
Sequence

81 - 

uaaugccccuaaaaauccuuau

 - 102

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).