Stem-loop sequence tgu-mir-454

AccessionMI0013807 (change log)
DescriptionTaeniopygia guttata miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   ---------        ---         -  -       ug 
5'          gacccuau   caauauugc cu cugcuuu  u
            ||||||||   ||||||||| || |||||||  g
3'          cugggaua   guuauaacg ga gauggga  a
   uuuucuuuu        uuc         u  u       cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr15: 8486784-8486856 [+]
sense
ENSTGUT00000018330 ; tgu-mir-454-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-454
tgu-mir-130achr15: 8478910-8478981 [+]
tgu-mir-454chr15: 8486784-8486856 [+]
tgu-mir-130bchr15: 8487921-8488052 [+]
Database links

Mature sequence tgu-miR-454-5p

Accession MIMAT0027011
Sequence

2 - 

acccuaucaauauugccucugcu

 - 24

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-454-3p

Accession MIMAT0014580
Sequence

41 - 

uagugcaauauugcuuauagggu

 - 63

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).