Stem-loop sequence tgu-mir-135a-1

AccessionMI0013777 (change log)
DescriptionTaeniopygia guttata miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   ucuag               u            u g a 
5'      uguuuuauggcuuuu auuccuauguga a u a
        ||||||||||||||| |||||||||||| | | u
3'      auaaaguaccgaagg uagggauguacu u a a
   -----               -            c g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1A: 45650428-45650500 [+]
sense
ENSTGUT00000018612 ; tgu-mir-135a-1-201; exon 1
Database links

Mature sequence tgu-miR-135a-5p

Accession MIMAT0014559
Previous IDstgu-miR-135a
Sequence

11 - 

uauggcuuuuuauuccuauguga

 - 33

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-135a-1-3p

Accession MIMAT0014643
Previous IDstgu-miR-135a*
Sequence

50 - 

uguagggauggaagccauga

 - 69

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).