Stem-loop sequence tgu-mir-194-1

AccessionMI0013775 (change log)
DescriptionTaeniopygia guttata miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   ug  c   uau         a      g    cuac 
5'   cu uca   guaacagca cuccau ugga    a
     || |||   ||||||||| |||||| ||||    c
3'   gg agu   cauugucgu gaggug accu    u
   --  u   uuu         a      -    ucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr3: 9653586-9653657 [+]
sense
ENSTGUT00000018648 ; tgu-mir-194-1-201; exon 1
antisense
Clustered miRNAs
< 10kb from tgu-mir-194-1
tgu-mir-194-1chr3: 9653586-9653657 [+]
tgu-mir-215chr3: 9653905-9653975 [+]
Database links

Mature sequence tgu-miR-194-5p

Accession MIMAT0014558
Sequence

11 - 

uguaacagcaacuccaugugga

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence tgu-miR-194-3p

Accession MIMAT0027001
Sequence

45 - 

ccaguggagaugcuguuacuuu

 - 66

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).