Stem-loop sequence tgu-mir-15a

AccessionMI0013772 (change log)
DescriptionTaeniopygia guttata miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention tgu-mir-15a
(1 sentences)

Stem-loop
   uggcauaac ua        ua         gggu   g 
5'          g  gcagcaca  augguuugu    uuu a
            |  ||||||||  |||||||||    |||  
3'          c  cgucgugu  uaccggacg    gga a
   ------aaa uc        ua         ---u   a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1: 55909891-55909961 [+]
sense
ENSTGUT00000018415 ; tgu-mir-15a-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-15a
tgu-mir-15achr1: 55909891-55909961 [+]
tgu-mir-16achr1: 55910032-55910123 [+]
Database links

Mature sequence tgu-miR-15a-5p

Accession MIMAT0014555
Sequence

11 - 

uagcagcacauaaugguuugu

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-15a-3p

Accession MIMAT0027000
Sequence

48 - 

caggccauauugugcugccuca

 - 69

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).