Stem-loop sequence tgu-mir-20a

Accession MI0013770
Description Taeniopygia guttata miR-20a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cuug   c   -a                 ----g    g 
    uag acu  aagugcuuauagugcag     uagu u
    ||| |||  |||||||||||||||||     ||||  
    guc uga  uucacgaauauuacguc     auca u
----   a   aa                 aucua    c 
Get sequence
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1: 43202624-43202696 [-]
sense
Clustered miRNAs
< 10kb from tgu-mir-20a
tgu-mir-17a chr1: 43203076-43203147 [-]
tgu-mir-18a chr1: 43202937-43203008 [-]
tgu-mir-19a chr1: 43202791-43202860 [-]
tgu-mir-20a chr1: 43202624-43202696 [-]
tgu-mir-19b-1 chr1: 43202482-43202554 [-]
tgu-mir-92-1 chr1: 43202366-43202437 [-]

Mature sequence tgu-miR-20a

Accession MIMAT0014553
Sequence

11 - 

uaaagugcuuauagugcagguag

 - 33

Get sequence
Evidence experimental; 454 [1], Solexa [1]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).