Stem-loop sequence tgu-mir-33

AccessionMI0013752 (change log)
DescriptionTaeniopygia guttata miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   ggcagcuguag          uu         -  ug g 
5'            ugcauuguag  gcauugcau gu  u g
              ||||||||||  ||||||||| ||  |  
3'            acgugacguc  uguaacgug ca  g c
   ---------ug          uu         u  gu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1A: 48937654-48937723 [-]
sense
ENSTGUT00000010119 ; SMDT1-201; intron 1
ENSTGUT00000018804 ; tgu-mir-33-201; exon 1
Database links

Mature sequence tgu-miR-33-5p

Accession MIMAT0014538
Sequence

11 - 

gugcauuguaguugcauugc

 - 30

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-33-3p

Accession MIMAT0026993
Sequence

51 - 

caauguuucugcagugcagu

 - 70

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).