Stem-loop sequence tgu-mir-383

AccessionMI0013744 (change log)
DescriptionTaeniopygia guttata miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   ccugcuccuca      aa    a        --    gu 
5'            gaucag  ggug uuguggcu  uuga  a
              ||||||  |||| ||||||||  ||||  a
3'            cugguc  ucac gacaccga  aauu  a
   --------aga      cg    -        cg    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr4: 42215192-42215263 [+]
sense
ENSTGUT00000018314 ; tgu-mir-383-201; exon 1
Database links

Mature sequence tgu-miR-383-5p

Accession MIMAT0014531
Sequence

11 - 

agaucagaaggugauuguggcu

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-383-3p

Accession MIMAT0026989
Sequence

52 - 

ccacagcacugccuggucaga

 - 72

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).