Stem-loop sequence tgu-let-7c-1

Accession MI0013726
Description Taeniopygia guttata let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--------  a      uu   g   u             ua  g ua a 
        gc uccggg  gag uag agguuguaugguu  ga u  c c
        || ||||||  ||| ||| |||||||||||||  || |  | c
        cg agguuc  uuc auc uccaacaugucaa  uu a  g c
aguucaca  -      cu   g   u             --  g gg u 
Get sequence
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1: 109662682-109662773 [+]
sense
antisense
Clustered miRNAs
< 10kb from tgu-let-7c-1
tgu-mir-99-1 chr1: 109661967-109662037 [+]
tgu-let-7c-1 chr1: 109662682-109662773 [+]

Mature sequence tgu-let-7c

Accession MIMAT0014520
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Evidence experimental; 454 [1], Solexa [1]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).