Stem-loop sequence tgu-mir-26-1

AccessionMI0013717 (change log)
DescriptionTaeniopygia guttata miR-26-1 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   uguggccu   u         c         -u  aucc 
5'         ggu caaguaauc aggauaggc  gu    a
           ||| ||||||||| |||||||||  ||     
3'         uca guucauugg ucuuauccg  ca    u
   -------g   c         u         cu  aucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr2: 4696535-4696606 [+]
sense
ENSTGUT00000018738 ; tgu-mir-26-1-201; exon 1
Database links

Mature sequence tgu-miR-26-5p

Accession MIMAT0014516
Sequence

11 - 

uucaaguaauccaggauaggcu

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence tgu-miR-26-3p

Accession MIMAT0026980
Sequence

50 - 

ccuauucuugguuacuugcacu

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).