Stem-loop sequence tgu-mir-138-1

Accession MI0013715
Description Taeniopygia guttata miR-138-1 stem-loop
Gene family MIPF0000075; mir-138
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-138. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-138 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-138 precursor is the microRNA mir-138. miR-138 has been used as an example of the post-transcriptional regulation of miRNA, due to the finding that while the precursor is expressed ubiquitously, the mature product is found only in specific cell types.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gcugugcaacag             uca      - a  a 
            cugguguugugaa   ggccgu c cc g
            |||||||||||||   |||||| | ||  
            gaccacaacacuu   ucggca g gg u
-------gcugg             -ca      a a  c 
Get sequence
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr2: 61107967-61108039 [-]
sense
Clustered miRNAs
< 10kb from tgu-mir-138-1
tgu-mir-138-1 chr2: 61107967-61108039 [-]
tgu-mir-2972 chr2: 61107767-61107870 [-]

Mature sequence tgu-miR-138

Accession MIMAT0014515
Sequence

11 - 

agcugguguugugaaucaggccg

 - 33

Get sequence
Evidence experimental; 454 [1], Solexa [1]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).