Stem-loop sequence tgu-mir-124-2

Accession

MI0013699

Description

Taeniopygia guttata miR-124-2 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

----------cc        a   ga        uaaau 
            guguucac gcg  ccuugauu     g
            |||||||| |||  ||||||||     u
            cguaagug cgc  ggaauuaa     c
cggagcaagaac        g   ac        cauac 

Genome context

• Coordinates (taeGlu3.2.4): chr3: 111968090-111968160 [+]
• Overlapping transcripts:

  sense

  ENSTGUT00000018522 ; exon 1

  ENSTGUT00000018522 ; exon 1

  ENSTGUT00000018522 ; exon 1

Mature sequence tgu-miR-124-5p

• Accession: MIMAT0014630
• Previous IDs: tgu-miR-124*
• Sequence: 2 - cguguucacagcggaccuuga - 22
• Evidence: experimental; 454 [1]

Mature sequence tgu-miR-124-3p

• Accession: MIMAT0014507
• Previous IDs: tgu-miR-124
• Sequence: 41 - uaaggcacgcggugaaugcca - 61
• Evidence: experimental; 454 [1]

References

1. PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).