Stem-loop sequence tgu-mir-146a

AccessionMI0013652 (change log)
DescriptionTaeniopygia guttata miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   u    c aa  uug    uu  c    cu           u           uuc  gu 
5'  guga g  ug   gcag  cc agcu  gagaacugaau ccauggacugg   ca  u
    |||| |  ||   ||||  || ||||  ||||||||||| |||||||||||   ||   
3'  cacu c  ac   cguc  gg ucga  cucuugacuua gguaccugacu   gu  c
   a    u aa  -ua    --  u    -u           u           ugu  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr4: 69209753-69209868 [-]
sense
ENSTGUT00000018418 ; tgu-mir-146a-201; exon 1
ENSTGUT00000011457 ; DDRGK1-202; intron 6
ENSTGUT00000011460 ; DDRGK1-203; intron 6
ENSTGUT00000011455 ; DDRGK1-201; intron 8
Database links

Mature sequence tgu-miR-146a-5p

Accession MIMAT0014622
Previous IDstgu-miR-146a*
Sequence

29 - 

ugagaacugaauuccauggacu

 - 50

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-146a-3p

Accession MIMAT0014465
Previous IDstgu-miR-146a
Sequence

71 - 

aguccaugguauucaguucucu

 - 92

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).