Stem-loop sequence tgu-mir-1662

AccessionMI0013646 (change log)
DescriptionTaeniopygia guttata miR-1662 stem-loop
Gene family MIPF0000918; mir-1662
Stem-loop
   u             u aua        guaug 
5'  gggcuugacauca c   cuugggau     a
    ||||||||||||| |   ||||||||      
3'  cccggacuguagu g   gaacccug     c
   a             c gac        aagca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr2: 2943947-2944012 [-]
sense
ENSTGUT00000018495 ; tgu-mir-1662-201; exon 1
ENSTGUT00000000297 ; VIPR1-201; intron 8
Clustered miRNAs
< 10kb from tgu-mir-1662
tgu-mir-2988chr2: 2951825-2951932 [-]
tgu-mir-1662chr2: 2943947-2944012 [-]
Database links

Mature sequence tgu-miR-1662

Accession MIMAT0014459
Sequence

6 - 

uugacaucaucauacuugggau

 - 27

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).