Stem-loop sequence tgu-mir-1784

AccessionMI0013644 (change log)
DescriptionTaeniopygia guttata miR-1784 stem-loop
Gene family MIPF0001873; mir-1784
Stem-loop
   uga         g                  g  a      agag 
5'    uuucuuggg cccaauucugcucuuauu aa ucagug    u
      ||||||||| |||||||||||||||||| || ||||||     
3'    ggagaaucc ggguuaagacgaggguaa uu aguuac    c
   aca         a                  a  c      cguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr3: 31872434-31872525 [-]
sense
ENSTGUT00000018447 ; tgu-mir-1784-201; exon 1
ENSTGUT00000008498 ; PLD5-201; intron 7
Database links

Mature sequence tgu-miR-1784-5p

Accession MIMAT0026960
Sequence

19 - 

uucugcucuuauugaaaucagu

 - 40

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-1784-3p

Accession MIMAT0014457
Sequence

55 - 

ugacuuaaaugggagcagaauu

 - 76

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).