Stem-loop sequence tgu-mir-1677

AccessionMI0013638 (change log)
DescriptionTaeniopygia guttata miR-1677 stem-loop
Gene family MIPF0000849; mir-1677
Stem-loop
         - u        a  -gc            aag 
5' uagggu c gauccugc cc   ugaagucaaugg   c
   |||||| | |||||||| ||   ||||||||||||    
3' auucca g uuaggacg gg   acuucaguuacu   u
         a u        a  aua            guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr3: 76231058-76231133 [+]
sense
ENSTGUT00000012862 ; EPHA7-201; intron 5
Database links

Mature sequence tgu-miR-1677-5p

Accession MIMAT0014452
Sequence

11 - 

uccugcaccgcugaaguca

 - 29

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence tgu-miR-1677-3p

Accession MIMAT0026959
Sequence

45 - 

uugacuucaauaggagcaggauu

 - 67

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).