Stem-loop sequence gga-mir-2954

AccessionMI0013634 (change log)
DescriptionGallus gallus miR-2954 stem-loop
Gene family MIPF0001032; mir-2954
Literature search

6 open access papers mention gga-mir-2954
(38 sentences)

Stem-loop
   cug        -ug     a   u  ua -   a 
5'    agagggcu   gggag gga ug  g ugg g
      ||||||||   ||||| ||| ||  | |||  
3'    ucucucga   uccuc ccu ac  c acc c
   cgg        cga     a   u  cc u   u 
Get sequence
Deep sequencing
249979 reads, 2.78e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 70733043-70733110 [+]
sense
ENSGALT00000043939 ; gga-mir-2954-201; exon 1
ENSGALT00000044607 ; XPA-201; intron 3
Clustered miRNAs
< 10kb from gga-mir-2954
gga-mir-2954chrZ: 70733043-70733110 [+]
gga-mir-1583chrZ: 70734341-70734438 [+]
Database links

Mature sequence gga-miR-2954

Accession MIMAT0014448
Sequence

37 - 

cauccccauuccacuccuagca

 - 58

Get sequence
Deep sequencing249606 reads, 5 experiments
Evidence experimental; Northern [1]
Database links
Predicted targets

References

1
PMID:20220842 "Somatic sex identity is cell autonomous in the chicken" Zhao D, McBride D, Nandi S, McQueen HA, McGrew MJ, Hocking PM, Lewis PD, Sang HM, Clinton M Nature. 464:237-242(2010).