Stem-loop sequence cel-mir-2953

AccessionMI0013633 (change log)
DescriptionCaenorhabditis elegans miR-2953 stem-loop
Stem-loop
   --        u   c    aa     uaug 
5'   uacagaag guu guga  auaaa    u
     |||||||| ||| ||||  |||||    g
3'   augucuuc cga cacu  uauuu    u
   cg        u   u    ag     uuuu 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 6747182-6747242 [+]
sense
F41G3.5 ; F41G3.5; intron 2
Database links

Mature sequence cel-miR-2953-5p

Accession MIMAT0014446
Sequence

1 - 

uacagaaguguucgugaaaau

 - 21

Get sequence
Deep sequencing11 reads, 6 experiments
Evidence experimental; CLIPseq [1], Illumina [2]
Predicted targets

Mature sequence cel-miR-2953-3p

Accession MIMAT0014447
Sequence

41 - 

gaucacuagcucuucuguagc

 - 61

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental; CLIPseq [1], Illumina [2]
Predicted targets

References

1
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
2