Stem-loop sequence cqu-mir-309

AccessionMI0013631 (change log)
DescriptionCulex quinquefasciatus miR-309 stem-loop
Gene family MIPF0000140; mir-3
Literature search

1 open access papers mention cqu-mir-309
(2 sentences)

Stem-loop
   -  -gc      --      u      cg       uug  g  cu 
5'  gc   ucgguu  uaugcg caaacu  gcucagu   gu aa  u
    ||   ||||||  |||||| ||||||  |||||||   || ||  u
3'  cg   aguuag  auacgc guuuga  cggguca   ca uu  g
   a  gaa      ua      u      ua       cua  g  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.145: 66026-66116 [-]
intergenic
Database links

Mature sequence cqu-miR-309

Accession MIMAT0014444
Sequence

54 - 

ucacugggcauaguuugucgc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).