Stem-loop sequence cqu-mir-1889

AccessionMI0013628 (change log)
DescriptionCulex quinquefasciatus miR-1889 stem-loop
Gene family MIPF0000954; mir-1889
Literature search

2 open access papers mention cqu-mir-1889
(6 sentences)

Stem-loop
   -uu    c u     a u        a       a      uuuuucaacggcaaagcacaaacuuugaa 
5'    gcac g cccgg g aaucucaa uuguaac gugggu                             a
      |||| | ||||| | |||||||| ||||||| ||||||                              
3'    cgug c gggcc c uugggguu gacauug caccca                             c
   ugc    - u     c u        a       -      uaucguuuacaagagagcuugccucccug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.57: 562539-562677 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-1889
cqu-mir-283supercont3.57: 559440-559549 [+]
cqu-mir-1889supercont3.57: 562539-562677 [+]
cqu-mir-12supercont3.57: 562944-563041 [+]
Database links

Mature sequence cqu-miR-1889-5p

Accession MIMAT0014440
Previous IDscqu-miR-1889
Sequence

17 - 

uaaucucaaauuguaacagugg

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-1889-3p

Accession MIMAT0014441
Previous IDscqu-miR-1889*
Sequence

104 - 

cacguuacagauugggguuucc

 - 125

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).