Stem-loop sequence cqu-mir-306

AccessionMI0013626 (change log)
DescriptionCulex quinquefasciatus miR-306 stem-loop
Stem-loop
   uu    c          -  a   u   c ugau  cau 
5'   ggcu agguacugag ug cuc cag g    ac   u
     |||| |||||||||| || ||| ||| |    ||    
3'   ccgg uccauggcuc ac gag guc c    ug   u
   --    u          c  -   u   - ---u  acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.83: 80431-80502 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-306
cqu-mir-306supercont3.83: 80431-80502 [+]
cqu-mir-79supercont3.83: 80583-80657 [+]
Database links

Mature sequence cqu-miR-306

Accession MIMAT0014438
Sequence

6 - 

ucagguacugagugacucucag

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).