Stem-loop sequence cqu-mir-2951

AccessionMI0013621 (change log)
DescriptionCulex quinquefasciatus miR-2951 stem-loop
Literature search

1 open access papers mention cqu-mir-2951
(14 sentences)

Stem-loop
   -gg    -gc    c    a ----      -   ac 
5'    aaga   ucag acgc g    gggugg cgc  u
      ||||   |||| |||| |    |||||| |||  a
3'    uuuu   gguc ugug c    cccauc gcg  c
   cug    aaa    a    c uugg      u   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.1464: 4408-4477 [+]
intergenic
supercont3.1464: 13130-13199 [+]
intergenic
supercont3.1464: 21931-22000 [+]
intergenic
supercont3.1464: 30698-30767 [+]
intergenic
supercont3.1464: 39499-39568 [+]
intergenic
supercont3.1464: 48275-48344 [+]
intergenic
supercont3.1464: 56986-57055 [+]
intergenic
supercont3.679: 54985-55054 [+]
intergenic
Database links

Mature sequence cqu-miR-2951-5p

Accession MIMAT0014432
Previous IDscqu-miR-2951
Sequence

4 - 

agagcucagcacgcagggguggc

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-2951-3p

Accession MIMAT0014433
Previous IDscqu-miR-2951*
Sequence

32 - 

acccgcgucuacccgguuccguguacuggaaau

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).