Stem-loop sequence cqu-mir-33

AccessionMI0013620 (change log)
DescriptionCulex quinquefasciatus miR-33 stem-loop
Gene family MIPF0000070; mir-33
Literature search

2 open access papers mention cqu-mir-33
(6 sentences)

Stem-loop
   ------  -g          -----        c  g     c 
5'       gg  ugcauuguag     uugcauug ac uuuug g
         ||  ||||||||||     |||||||| || |||||  
3'       cc  acguaacguc     gacgugac ug aaagc u
   ggugga  aa          uucau        c  a     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.1258: 69328-69403 [-]
intergenic
Database links

Mature sequence cqu-miR-33

Accession MIMAT0014431
Sequence

3 - 

gugcauuguaguugcauugca

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).