Stem-loop sequence cqu-mir-1890

AccessionMI0013615 (change log)
Previous IDscqu-mir-1890-1
DescriptionCulex quinquefasciatus miR-1890 stem-loop
Gene family MIPF0000848; mir-1890
Literature search

2 open access papers mention cqu-mir-1890
(5 sentences)

Stem-loop
   -          g     ug    c   u   auc  gu 
5'  uacggccaga cuaau  gaga uuc uga   gu  u
    |||||||||| |||||  |||| ||| |||   ||  g
3'  guguuggucu gauua  uucu aag acu   ca  u
   g          g     gu    a   u   -ga  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.64: 982780-982856 [-]
intergenic
Database links

Mature sequence cqu-miR-1890

Accession MIMAT0014427
Sequence

50 - 

ugaaaucuuugauuaggucugg

 - 71

Get sequence
Evidence experimental;

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).