Stem-loop sequence cqu-mir-184

AccessionMI0013613 (change log)
DescriptionCulex quinquefasciatus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention cqu-mir-184
(6 sentences)

Stem-loop
   ---   u     ca         -     u  -  --c    u  u 
5'    gug auucg  cccuuauca uucuu cg cc   cgug ac g
      ||| |||||  ||||||||| ||||| || ||   |||| ||  
3'    cac ugggc  gggaauagu aagag gc gg   gcgu ug u
   uuc   -     cc         c     -  a  uca    u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.567: 240300-240384 [-]
intergenic
Database links

Mature sequence cqu-miR-184

Accession MIMAT0014424
Sequence

52 - 

uggacggagaacugauaagggc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).