Stem-loop sequence cqu-mir-7

AccessionMI0013612 (change log)
DescriptionCulex quinquefasciatus miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

1 open access papers mention cqu-mir-7
(1 sentences)

Stem-loop
   uc    u  u     u        a u     u      ug   ua 
5'   gcaa au uugua ggaagacu g gauuu guuguu  gcu  a
     |||| || ||||| |||||||| | ||||| ||||||  |||   
3'   cguu ug aacau cuuucuga c cuaaa uaacaa  uga  g
   gu    -  c     -        c u     -      --   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.1: 3357339-3357427 [-]
intergenic
Database links

Mature sequence cqu-miR-7

Accession MIMAT0014423
Sequence

16 - 

uggaagacuagugauuuuguugu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).