Stem-loop sequence cqu-mir-1891

AccessionMI0013611 (change log)
DescriptionCulex quinquefasciatus miR-1891 stem-loop
Gene family MIPF0000857; mir-1891
Literature search

2 open access papers mention cqu-mir-1891
(4 sentences)

Stem-loop
   --    uc        uga         uu        uug a 
5'   uuuu  ugucaugu   ggaguuaau  gcguguuu   c u
     ||||  ||||||||   |||||||||  ||||||||   |  
3'   aaaa  guaguaca   ucucaauua  ugcacaaa   g u
   cg    ua        ugg         cc        uua c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.829: 180333-180418 [-]
intergenic
Database links

Mature sequence cqu-miR-1891

Accession MIMAT0014422
Sequence

15 - 

ugaggaguuaauuugcguguuu

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).