Stem-loop sequence cqu-mir-14

AccessionMI0013607 (change log)
DescriptionCulex quinquefasciatus miR-14 stem-loop
Gene family MIPF0000182; mir-14
Stem-loop
   -----------c   a  a   u       c    uu      u   ggu   ac 
5'             ccg ua gcc gugggag gaga  aaggcu gcu   uuc  g
               ||| || ||| ||||||| ||||  |||||| |||   |||   
3'             ggc au ugg uauccuc cucu  uucuga uga   gag  u
   gagcaacuucgu   a  a   u       u    uu      c   aau   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.676: 52228-52328 [-]
intergenic
Database links

Mature sequence cqu-miR-14

Accession MIMAT0014416
Sequence

57 - 

ucagucuuuuucucucuccuau

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).