Stem-loop sequence cqu-mir-2

AccessionMI0013604 (change log)
DescriptionCulex quinquefasciatus miR-2 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
            ca    -     -         a     uccuc 
5' aacuguauc  cucu caaag uggcuguga auggu     c
   |||||||||  |||| ||||| ||||||||| |||||     a
3' uuggcauag  gaga guuuc accgacacu uaccg     g
            -c    a     g         a     cuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.366: 116852-116935 [-]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-2
cqu-mir-71supercont3.366: 117497-117578 [-]
cqu-mir-13supercont3.366: 116988-117069 [-]
cqu-mir-2supercont3.366: 116852-116935 [-]
Database links

Mature sequence cqu-miR-2

Accession MIMAT0014412
Sequence

53 - 

uaucacagccagcuuugaagagc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).