Stem-loop sequence cqu-mir-285

AccessionMI0013603 (change log)
DescriptionCulex quinquefasciatus miR-285 stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention cqu-mir-285
(1 sentences)

Stem-loop
   aa      gc   c  a    ag    ug  auuc 
5'   guacug  uuc aa ggug  uaga  gc    g
     ||||||  ||| || ||||  ||||  ||     
3'   caugac  aag uu ccac  aucu  cg    a
   --      ua   c  a    -g    --  cuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.98: 262290-262356 [-]
intergenic
Database links

Mature sequence cqu-miR-285-5p

Accession MIMAT0014410
Previous IDscqu-miR-285*
Sequence

5 - 

acuggcuuccaaaggugaguaga

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-285-3p

Accession MIMAT0014411
Previous IDscqu-miR-285
Sequence

46 - 

uagcaccauucgaaaucaguac

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).