Stem-loop sequence cqu-mir-8

Accession MI0013602
Description Culex quinquefasciatus miR-8 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
guc  uu -       -   g     c      --    u 
   ug  c acaucuu acc ggcag auuaga  uauu u
   ||  | ||||||| ||| ||||| ||||||  |||| u
   gc  g uguagaa ugg cuguc uaaucu  auaa u
--a  cu c       a   a     a      uc    a 
Get sequence
Deep sequencing
11517 reads, 1 experiments
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.40: 815858-815934 [-]
intergenic

Mature sequence cqu-miR-8-5p

Accession MIMAT0014408
Previous IDs cqu-miR-8*
Sequence

10 - 

caucuuaccgggcagcauuaga

 - 31

Get sequence
Deep sequencing 597 reads, 1 experiments
Evidence experimental; Solexa [1]

Mature sequence cqu-miR-8-3p

Accession MIMAT0014409
Previous IDs cqu-miR-8
Sequence

49 - 

uaauacugucagguaaagaugu

 - 70

Get sequence
Deep sequencing 10920 reads, 1 experiments
Evidence experimental; Solexa [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).