Stem-loop sequence cqu-mir-8

AccessionMI0013602 (change log)
DescriptionCulex quinquefasciatus miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

2 open access papers mention cqu-mir-8
(11 sentences)

Stem-loop
   guc  uu -       -   g     c      --    u 
5'    ug  c acaucuu acc ggcag auuaga  uauu u
      ||  | ||||||| ||| ||||| ||||||  |||| u
3'    gc  g uguagaa ugg cuguc uaaucu  auaa u
   --a  cu c       a   a     a      uc    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.40: 815858-815934 [-]
intergenic
Database links

Mature sequence cqu-miR-8-5p

Accession MIMAT0014408
Previous IDscqu-miR-8*
Sequence

10 - 

caucuuaccgggcagcauuaga

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-8-3p

Accession MIMAT0014409
Previous IDscqu-miR-8
Sequence

49 - 

uaauacugucagguaaagaugu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).